View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_225 (Length: 279)
Name: NF0154_2D_low_225
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_low_225 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 12 - 261
Target Start/End: Complemental strand, 35795315 - 35795066
Alignment:
| Q |
12 |
atgaaaaccaaagtagagtgcatggaatttttatcaaacaaattgtaagatgctatttagtataataactaaacaacagaaacacacatgaacgtggaaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35795315 |
atgaaaaccaaagtagagtgcatggaatttttatcaaacaaattgtaagatgctatttagtataataactaaacaacagaaacacacatgaacgtggaaa |
35795216 |
T |
|
| Q |
112 |
tatggtcttaagnnnnnnnngaagagagataaaaatggaagtgcattactttataacttatcataatcacttttgtttaaggtgacagctaatttgagag |
211 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35795215 |
tatggtcttaagaaaaaaaagaagagagataaaaatggaagtgcattactttataacttatcataatcacttttgtttaaggtgacagctaatttgagag |
35795116 |
T |
|
| Q |
212 |
agtttacaacactgctgatttcattagctgttggtacacatgatatatgt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35795115 |
agtttacaacactgctgatttcattagctgttggtacacatgatatatgt |
35795066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1818 times since January 2019
Visitors: 2198