View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_227 (Length: 278)
Name: NF0154_2D_low_227
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_low_227 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 9 - 261
Target Start/End: Complemental strand, 39748018 - 39747767
Alignment:
| Q |
9 |
aagaaagatattcatagttggatcagaaccatattaagaagattcaattgaaattgtaaacnnnnnnnnttgtactatttttacaatcccttgtttttag |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |||| || |
|
|
| T |
39748018 |
aagaaagatattcatagttggatcagaaccatattaagaagattcaattgaaattgtaaa-aaaaaaaattgtactattttaacaatcccttattttcag |
39747920 |
T |
|
| Q |
109 |
gggaaagagatatgataatctaaagtttagtcgagaggtaattgaagtctgataaaaaattgtttcacacataaatcaaaatcttcacattgttgatgtc |
208 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
39747919 |
gggaatgagatatgataatctaaagtttagtcgagaggtaagtgaagtctaataaaaaattgtttaacacataaatcaaaatctttacattgttgatgtc |
39747820 |
T |
|
| Q |
209 |
atgcattaaattagtctttaattaatattaatatgtggaaatacctaaatatt |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39747819 |
atgcattaaattagtctttaattaatattaatatgtggaaatacctaaatatt |
39747767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 156 - 188
Target Start/End: Complemental strand, 41932077 - 41932045
Alignment:
| Q |
156 |
tctgataaaaaattgtttcacacataaatcaaa |
188 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
41932077 |
tctgataaaaaattgtttcactcataaatcaaa |
41932045 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1721 times since January 2019
Visitors: 2196