View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_228 (Length: 278)
Name: NF0154_2D_low_228
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_low_228 |
 |  |
|
| [»] scaffold0094 (2 HSPs) |
 |  |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 3e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 26 - 178
Target Start/End: Complemental strand, 36859367 - 36859214
Alignment:
| Q |
26 |
accggcaaagatctcttgattcctcgcggccgggccggcttggaagcaa-gctacctgtcgcctatctcaccccctttcttattattagtaagataggtt |
124 |
Q |
| |
|
||||| ||||||||||||||||||||||| | || || |||| |||||| ||||| |||| |||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
36859367 |
accggaaaagatctcttgattcctcgcggtcaggacgacttgtaagcaaagctacatgtcacctatctcacccactttcttattataagtaagataggtt |
36859268 |
T |
 |
| Q |
125 |
gcccctttcccctttctctaagaagaaggtaagcatccctcactgccgatcgcc |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
36859267 |
gcccctttcccctttctctaagaagaaggtaagcatccctcattgtcgatcgcc |
36859214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: scaffold0094
Description:
Target: scaffold0094; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 116 - 219
Target Start/End: Original strand, 41730 - 41833
Alignment:
| Q |
116 |
agataggttgcccctttcccctttctctaagaagaaggtaagcatccctcactgccgatcgccttcagcagggtgagccttcgctttttggatcgtcttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
41730 |
agataggttgcccctttcccctttctctaagaagaaggtaagcatcccttactgccgatcaccttcaacagggtgagcctttgctttttggatcgtcttc |
41829 |
T |
 |
| Q |
216 |
tgcc |
219 |
Q |
| |
|
|||| |
|
|
| T |
41830 |
tgcc |
41833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0094; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 219 - 278
Target Start/End: Complemental strand, 41903 - 41844
Alignment:
| Q |
219 |
catggggtcgacctgtaaacaaggtaaacccaatgggaaccaaaaacgggagggtaccac |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41903 |
catggggtcgacctgtaaacaaggtaaacccaatgggaaccaaaaacgggagggtaccac |
41844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 64; Significance: 5e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 215 - 278
Target Start/End: Original strand, 37882279 - 37882342
Alignment:
| Q |
215 |
ctgccatggggtcgacctgtaaacaaggtaaacccaatgggaaccaaaaacgggagggtaccac |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37882279 |
ctgccatggggtcgacctgtaaacaaggtaaacccaatgggaaccaaaaacgggagggtaccac |
37882342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University