View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_235 (Length: 271)
Name: NF0154_2D_low_235
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_235 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 9 - 253
Target Start/End: Original strand, 30114898 - 30115142
Alignment:
Q |
9 |
tggtgttgacgaacaaagcatattagaggcaaatgagttgcaaccaagtgaaaacagaagtgtgattctctttgcgttgacaccgatattagttcctctt |
108 |
Q |
|
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
30114898 |
tggtgttgatgaacaaagcatattagaggcaaatgagttgcaaccaagtgaaaacagaagtgtgattctctttgcgttgacaccgatattacttcctctt |
30114997 |
T |
 |
Q |
109 |
agaggcaagagctgcaaagaagatcctgatagtttctactgtacttgttctcagggaaggctagcagatggaagttgttttgaatcccatggtcaaaatt |
208 |
Q |
|
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| | |
|
|
T |
30114998 |
agaggcaagagctgcaaagaggatcctgatagtttctactgtacttgttctcagggaaggctagcagatggaagttgtaatgaatcccatggtcaaaagt |
30115097 |
T |
 |
Q |
209 |
ttcctgccaagttggttgctgcattaggtaataatggattaaaat |
253 |
Q |
|
|
||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
T |
30115098 |
ttcctgccaagttggttgctgcattaggtaatattggactaaaat |
30115142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University