View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_242 (Length: 260)
Name: NF0154_2D_low_242
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_low_242 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 8e-76; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 1 - 152
Target Start/End: Complemental strand, 19077974 - 19077823
Alignment:
| Q |
1 |
ttttgatcaaagtgaaatgatgattgagataactaacgcatcatcgaatttgattattcctttgttgaggtaccaaagggaatggttaccatgggatttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19077974 |
ttttgatcaaagtgaaatgatgattgagataactaacgcatcatcgaatttgattattcctttgttgaggtaccaaagggaatggttaccgtgggatttg |
19077875 |
T |
 |
| Q |
101 |
agcaggatgttctataactagtggaggaatccttgccggtgaaaagggtatg |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19077874 |
agcaggatgttctataactagtggaggaatccttgccggtgaaaaggttatg |
19077823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 152 - 241
Target Start/End: Original strand, 19077629 - 19077718
Alignment:
| Q |
152 |
gggaaaattattcaagaacttttccttgtccttgctaagtgtgaattacaaccaatgtgatagaaattcacgtttagattatgactcttt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
19077629 |
gggaaaattattcaagaacttttccttgtccttgctaagcgtgaattacaaccaatgtgatagaaattcacgtttagataataactcttt |
19077718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 152 - 239
Target Start/End: Original strand, 19079354 - 19079441
Alignment:
| Q |
152 |
gggaaaattattcaagaacttttccttgtccttgctaagtgtgaattacaaccaatgtgatagaaattcacgtttagattatgactct |
239 |
Q |
| |
|
|||||||| ||||||||| || | ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
19079354 |
gggaaaataattcaagaatttgtgcttgtccttgctaagcgtgaattacaaccaatgtgatagaaattcacgtttagataatgactct |
19079441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 81 - 152
Target Start/End: Complemental strand, 19079619 - 19079548
Alignment:
| Q |
81 |
aatggttaccatgggatttgagcaggatgttctataactagtggaggaatccttgccggtgaaaagggtatg |
152 |
Q |
| |
|
||||||||||||| |||||||||| || ||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19079619 |
aatggttaccatgagatttgagcaagaagttctatcactagtggaggaatcctagccggtgaaaagggtatg |
19079548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 51 - 210
Target Start/End: Original strand, 17408846 - 17409008
Alignment:
| Q |
51 |
tgattattcctttgttgaggtaccaaagggaatggttaccatgggatttg-agcaggatg-ttctataactagtggaggaatccttgccggtgaaaaggg |
148 |
Q |
| |
|
||||| |||| ||| ||||||||||||||||||||||| |||||| |||| ||||||| | ||| |||| || |||||||||||||| | ||||| ||| |
|
|
| T |
17408846 |
tgattgttccgttgctgaggtaccaaagggaatggttagcatgggctttgaagcaggaggaatctgtaaccagaggaggaatccttgctgatgaaatggg |
17408945 |
T |
 |
| Q |
149 |
tat-gggaaaattattcaagaacttttccttgtccttgctaagtgtgaattacaaccaatgtg |
210 |
Q |
| |
|
||| ||||||| |||||||| | || |||||||||| |||| | ||||| |||| |||||| |
|
|
| T |
17408946 |
tatggggaaaactattcaagcaattgcccttgtcctttctaaacgggaattgcaacaaatgtg |
17409008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University