View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_265 (Length: 243)
Name: NF0154_2D_low_265
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_265 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 22 - 224
Target Start/End: Complemental strand, 3608002 - 3607808
Alignment:
Q |
22 |
aattatcaacctacaaggataaaagaagttgtgaacgcgggggaaaggagaaagaatgagaagaaaatatcaaggaaatgaacctccactttgcatagtt |
121 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3608002 |
aattatcaacctacaaggataaaagaagttgtgaacgcgg--------agaaagaatgagaagaaaatatcaaggaaatgaacctccactttgcatagtt |
3607911 |
T |
 |
Q |
122 |
tgaagaggatgagaataacaaccacttatatggaaccagtaatcctaacaatgactcagattctcaagctatcctcaaattgagtctgaatcacatgagt |
221 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3607910 |
tgaagaggatgagaataacaaccacttatatggaactagtaatcctaacaatgactcagattctcaagctatcctcaaattgagtctgaatcacatgagt |
3607811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University