View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_266 (Length: 241)
Name: NF0154_2D_low_266
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_266 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 39341897 - 39341667
Alignment:
Q |
1 |
atgtttaagtttgatgtctcgttggttcaagtgggtttatgttgaataagtcaacaattgaaagccttataggctctagttgagggtatcattgagaaat |
100 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39341897 |
atgtttaagtttgatgtctcgttagttcaagtgggtttatgttgaataagtcaacaattgaaagccttataggctctagttgagggtatcattgagaaat |
39341798 |
T |
 |
Q |
101 |
atggtataccattatgtaattcagatgatacttctgtcacttcatgtttgttgattttttccatgattagtgattgatgtttgcaacggtgttaggcatg |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39341797 |
atggtataccattatgtaattcagatgatacttttgccacttcatgtttgttgattttttccatgattagtgattgatgtttgcaacggtgttaggcatg |
39341698 |
T |
 |
Q |
201 |
atggtaacattacatacaatgcttatgatgt |
231 |
Q |
|
|
||||||||||||||||||||||||||||||| |
|
|
T |
39341697 |
atggtaacattacatacaatgcttatgatgt |
39341667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1691 times since January 2019
Visitors: 2195