View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_275 (Length: 233)
Name: NF0154_2D_low_275
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_275 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 3 - 213
Target Start/End: Original strand, 33352056 - 33352266
Alignment:
Q |
3 |
ttgcgttaatgattgcggttacgttggggatcaaatatggttgatgtggcctcaatcgcagtcgcagagacagtgaaaaaactgatgttgcagttgtgga |
102 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
T |
33352056 |
ttgcgttaatggttgcggttacgttggggatcaaatatggttgatgtggcctcaatcgcagtcacagagacagtgaaaaaactgatgttgcagtcgtgga |
33352155 |
T |
 |
Q |
103 |
cctttacttaaaacgttaccaatacttttgtttttactccgatagatattccattggaaaatatcaaatcaattgtacaataattttataatattccatt |
202 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33352156 |
cctttacttaaaaccttaccaatacttttgtttttactccgatagatattgcattggaaaatatcaaatcaattgtacaataattttataatattccatt |
33352255 |
T |
 |
Q |
203 |
ttttatatcat |
213 |
Q |
|
|
|| ||||||| |
|
|
T |
33352256 |
ttaaatatcat |
33352266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University