View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_283 (Length: 226)
Name: NF0154_2D_low_283
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_low_283 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 5265411 - 5265617
Alignment:
| Q |
1 |
atcaacatcaccggtcttccgaagtagcgttatatactgaaaatgaaaggaggatgaatcaagaagcgaattagtgtaacaataacttgattgaatggta |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5265411 |
atcaacatcaccggttttccgaagtagcgttatatactgaaaatgaaaggaggatgaatcaagcagcgaattagtgtaacaataacttgattgaatggta |
5265510 |
T |
|
| Q |
101 |
aagaaatgtgttcacaaaacctaactcaactgtcaaagatgtcgaaattgttaagctcagaagcattaaaagaaaagtaaagaaataagaattacttgca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5265511 |
aagaaatgtgttcacaaaacctaactcaactgtcaaatatgtcgaaattgttaagctcagaagcattaaaagaaaagtaaagaaataagaattacttgca |
5265610 |
T |
|
| Q |
201 |
aatgagc |
207 |
Q |
| |
|
||||||| |
|
|
| T |
5265611 |
aatgagc |
5265617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1571 times since January 2019
Visitors: 2193