View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_285 (Length: 225)
Name: NF0154_2D_low_285
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_285 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 49065251 - 49065451
Alignment:
Q |
19 |
gttttttcacttgcaactactgcaagagaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaagagagagaggtcaattgcaaaaag |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49065251 |
gttttttcacttgcaactactgcaagagaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaagagagagaggtcaattgcaaaaag |
49065350 |
T |
 |
Q |
119 |
aggacggaggacgatgttctcagcaacaggaacaacctcatttcttcataatcatcttcaccaccgttatgcaaatatggcatctctactaccactctat |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
49065351 |
aggacggaggacgatgttctcagcaacaggaacaacctcatttcttcataatcatcttcaccaccgttatgcaaatatggcatctctactaccactctat |
49065450 |
T |
 |
Q |
219 |
g |
219 |
Q |
|
|
| |
|
|
T |
49065451 |
g |
49065451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 45 - 123
Target Start/End: Complemental strand, 2867194 - 2867116
Alignment:
Q |
45 |
agaaaattcttcagttcacaagcacttgggggacatcaaaatgctcacaagagagagaggtcaattgcaaaaagaggac |
123 |
Q |
|
|
|||||||||| || ||||||||| | || ||||| |||||||||||||| |||||||| ||||| ||||||||||||| |
|
|
T |
2867194 |
agaaaattctatagctcacaagcattaggtggacaccaaaatgctcacaaaagagagagatcaatagcaaaaagaggac |
2867116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University