View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_290 (Length: 224)
Name: NF0154_2D_low_290
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_low_290 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 2 - 224
Target Start/End: Complemental strand, 1046230 - 1046007
Alignment:
| Q |
2 |
cttcgatgccgccgtgaagcctgccactgtcaaatcgaaa-ctctgcttcgagcctaaacctcatgtcaagcctaaagtcaccgccggtgtcattcctaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1046230 |
cttcgatgccgccgtgaagcctgccactgtcaaatcgaaaactctgcttcgagcctaaacctcatgtcaagcctaaagtcaccgccgctgtcattcctaa |
1046131 |
T |
 |
| Q |
101 |
agtcaccgccgctgtcaagtctttactcgtcaggcctaaactcatcgtcgccaacctgaagtgttgcttgccgttgtgaagttgaagatccaaccgcgac |
200 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1046130 |
agtcactgtcgctgtcaagtctttactcgtcaggcctaaactcatcgtcgccaacctgaagtgttgcttgccgttgtgaagttgaagatccaaccgcgac |
1046031 |
T |
 |
| Q |
201 |
atataggagagaatatctcgttga |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
1046030 |
atataggagagaatatctcgttga |
1046007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University