View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_302 (Length: 221)
Name: NF0154_2D_low_302
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_low_302 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 48703000 - 48702798
Alignment:
| Q |
1 |
taaacagtccatgtcaggatgcagacagtaagactaaaattgatggcatggctttagtaatannnnnnnatgagaagatgctgaaactcttaattgaaga |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
48703000 |
taaacagtccatgccaggatgcagacagtaagactaaaattgatggcatggctttagtaatatttttttatgagaagatgctgaaactcttaattgaaga |
48702901 |
T |
|
| Q |
101 |
atatgcaaattaagaaataatccaaaggctgaaaatccataccattgatgtcctctactgtgattaatgatggatgtgccaacacaacagcttgagtgag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48702900 |
atatgcaaattaagaaataatccaaaggctgaaaatccataccattgatgtcctctactgtgattaatgatggatgtgccaacacaacagcttgaatgag |
48702801 |
T |
|
| Q |
201 |
ttt |
203 |
Q |
| |
|
||| |
|
|
| T |
48702800 |
ttt |
48702798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 130 - 203
Target Start/End: Complemental strand, 48715297 - 48715224
Alignment:
| Q |
130 |
tgaaaatccataccattgatgtcctctactgtgattaatgatggatgtgccaacacaacagcttgagtgagttt |
203 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
48715297 |
tgaaaatccataccattgatgtcgtctactgtgatgtatgatggatgtgctaacacagcagcttgaatgagttt |
48715224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 155 - 207
Target Start/End: Complemental strand, 47168140 - 47168088
Alignment:
| Q |
155 |
ctactgtgattaatgatggatgtgccaacacaacagcttgagtgagttttgat |
207 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| ||||||| ||||||||||| |
|
|
| T |
47168140 |
ctactgtgatagatgatggatgtgctaacacagaagcttgaatgagttttgat |
47168088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1470 times since January 2019
Visitors: 2192