View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_303 (Length: 221)
Name: NF0154_2D_low_303
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_303 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 26619191 - 26619400
Alignment:
Q |
1 |
ttattactgaactatgagagcacaaggagcttatatacgcatattgaactctatgatagcttattgcaagtaacctacattagattgctaacacataaca |
100 |
Q |
|
|
||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26619191 |
ttattactgaattatgaga-cacaaggagcttatatacgcatattgaactctatgatagcttattgcaagtaacctacattagattgctaacacataaca |
26619289 |
T |
 |
Q |
101 |
aactcaaagctatgcaatgattaagtaatcatttctaactaacaactataactgccaactagttacttgttgcacaagtaatccatttattgttgatatg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26619290 |
aactcaaagctatgcaatgattaagtaatcatttctaactaacaactataactgccaactagttacttgttgcacaagtaatccatttattgttgatatg |
26619389 |
T |
 |
Q |
201 |
gtatgatgtcc |
211 |
Q |
|
|
||||||||||| |
|
|
T |
26619390 |
gtatgatgtcc |
26619400 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 30 - 140
Target Start/End: Complemental strand, 52548695 - 52548585
Alignment:
Q |
30 |
cttatatacgcatattgaactctatgatagcttattgcaagtaacctacattagattgctaacacataacaaactcaaagctatgcaatgattaagtaat |
129 |
Q |
|
|
|||||||||||||||||| ||||||| |||||||||| | ||||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||| |
|
|
T |
52548695 |
cttatatacgcatattgagctctatgttagcttattgtatgtaacctacattagattgctaacacttaacaaactcaaagttatgcaatgaataagtaat |
52548596 |
T |
 |
Q |
130 |
catttctaact |
140 |
Q |
|
|
||||||||||| |
|
|
T |
52548595 |
catttctaact |
52548585 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University