View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_2D_low_304 (Length: 218)

Name: NF0154_2D_low_304
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_2D_low_304
NF0154_2D_low_304
[»] chr2 (3 HSPs)
chr2 (25-121)||(18542190-18542286)
chr2 (55-121)||(18555277-18555343)
chr2 (51-114)||(18550295-18550358)
[»] chr6 (1 HSPs)
chr6 (128-197)||(27840239-27840308)


Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 25 - 121
Target Start/End: Original strand, 18542190 - 18542286
Alignment:
25 acccccgggtggaagttggacaagccatggagtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaagcacaggaggaaatggcagtgaa 121  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||    
18542190 acccccgggtggaagttggacaagccatggagtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaggcacaggaggaaatggtagtgaa 18542286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 55 - 121
Target Start/End: Original strand, 18555277 - 18555343
Alignment:
55 agtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaagcacaggaggaaatggcagtgaa 121  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||    
18555277 agtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaggcacaggaggaaatggcggtgaa 18555343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 51 - 114
Target Start/End: Original strand, 18550295 - 18550358
Alignment:
51 atggagtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaagcacaggaggaaatgg 114  Q
    |||||||||||||||| |||||||||||||||||||| ||||||||| || |||| | ||||||    
18550295 atggagtaaaaggaaatggtggtaaaggaggatcaaagggtggatcaggctcaggcgaaaatgg 18550358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 128 - 197
Target Start/End: Complemental strand, 27840308 - 27840239
Alignment:
128 gaacctgtgcaacgtgtggtgaacttgctattggcagccgatgggacggaggaaactaatgatatgttcg 197  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27840308 gaaccagtgcaacgtgtggtgaacttgctattggcagccgatgggacggaggaaactaatgatatgttcg 27840239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1645 times since January 2019
Visitors: 2194