View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_306 (Length: 218)
Name: NF0154_2D_low_306
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_306 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 89; Significance: 5e-43; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 25 - 121
Target Start/End: Original strand, 18542190 - 18542286
Alignment:
Q |
25 |
acccccgggtggaagttggacaagccatggagtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaagcacaggaggaaatggcagtgaa |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
T |
18542190 |
acccccgggtggaagttggacaagccatggagtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaggcacaggaggaaatggtagtgaa |
18542286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 55 - 121
Target Start/End: Original strand, 18555277 - 18555343
Alignment:
Q |
55 |
agtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaagcacaggaggaaatggcagtgaa |
121 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
T |
18555277 |
agtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaggcacaggaggaaatggcggtgaa |
18555343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 51 - 114
Target Start/End: Original strand, 18550295 - 18550358
Alignment:
Q |
51 |
atggagtaaaaggaaagggtggtaaaggaggatcaaaaggtggatcaagcacaggaggaaatgg |
114 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||| ||||||||| || |||| | |||||| |
|
|
T |
18550295 |
atggagtaaaaggaaatggtggtaaaggaggatcaaagggtggatcaggctcaggcgaaaatgg |
18550358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 128 - 197
Target Start/End: Complemental strand, 27840308 - 27840239
Alignment:
Q |
128 |
gaacctgtgcaacgtgtggtgaacttgctattggcagccgatgggacggaggaaactaatgatatgttcg |
197 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27840308 |
gaaccagtgcaacgtgtggtgaacttgctattggcagccgatgggacggaggaaactaatgatatgttcg |
27840239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University