View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_308 (Length: 216)
Name: NF0154_2D_low_308
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_308 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 33351806 - 33351945
Alignment:
Q |
19 |
atcaaaccggtgtgcttgaaaggtcgtctgtttggagaagtcaaccccttaaatagatattggtaatgggatcaacccaacaaaacnnnnnnntatttgt |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
T |
33351806 |
atcaaaccggtgtgcttgaaaggtcgtctgtttggagaagtcaaccccttaaatagatattggtaacgggatcaacccaacaaaacaaaaaaatatttgt |
33351905 |
T |
 |
Q |
119 |
tatgttttaattgattgaaggaaataattgaatggtgtga |
158 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33351906 |
tatgttttaattgattgaaggaaataattgaatggtgtga |
33351945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 168 - 216
Target Start/End: Complemental strand, 33351988 - 33351940
Alignment:
Q |
168 |
atcctatctcaaaaaattaacactagtatagtatccttccatttcacac |
216 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33351988 |
atcctatctcaaaaaattaacactagtatagtatccttccatttcacac |
33351940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University