View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_2D_low_310 (Length: 216)

Name: NF0154_2D_low_310
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_2D_low_310
NF0154_2D_low_310
[»] chr3 (1 HSPs)
chr3 (20-199)||(53810876-53811054)


Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 53811054 - 53810876
Alignment:
20 gtggtttcaactcaatggattaacagctttgggtattcaaaatattgtctatgaagtagattgtaagcaagtatagttgatacttgatggtatgatcaat 119  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53811054 gtggtttcaactcaatggatta-cagctttgggtattcaaaatattgtctatgaagtagattgtaagcaagtatagttgatacttgatggtatgatcaat 53810956  T
120 gttaatctaattgaacggactatgtgtccatcatagatcaatgtagagacatattagataactataacaactttcatgtt 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53810955 gttaatctaattgaacggactatgtgtccatcatagatcaatgtagagacatattagataactataacaactttcatgtt 53810876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University