View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_2D_low_313 (Length: 216)

Name: NF0154_2D_low_313
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_2D_low_313
NF0154_2D_low_313
[»] chr1 (2 HSPs)
chr1 (19-158)||(33351806-33351945)
chr1 (168-216)||(33351940-33351988)


Alignment Details
Target: chr1 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 19 - 158
Target Start/End: Original strand, 33351806 - 33351945
Alignment:
19 atcaaaccggtgtgcttgaaaggtcgtctgtttggagaagtcaaccccttaaatagatattggtaatgggatcaacccaacaaaacnnnnnnntatttgt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||       |||||||    
33351806 atcaaaccggtgtgcttgaaaggtcgtctgtttggagaagtcaaccccttaaatagatattggtaacgggatcaacccaacaaaacaaaaaaatatttgt 33351905  T
119 tatgttttaattgattgaaggaaataattgaatggtgtga 158  Q
    ||||||||||||||||||||||||||||||||||||||||    
33351906 tatgttttaattgattgaaggaaataattgaatggtgtga 33351945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 168 - 216
Target Start/End: Complemental strand, 33351988 - 33351940
Alignment:
168 atcctatctcaaaaaattaacactagtatagtatccttccatttcacac 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
33351988 atcctatctcaaaaaattaacactagtatagtatccttccatttcacac 33351940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University