View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_316 (Length: 216)
Name: NF0154_2D_low_316
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_316 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 53811054 - 53810876
Alignment:
Q |
20 |
gtggtttcaactcaatggattaacagctttgggtattcaaaatattgtctatgaagtagattgtaagcaagtatagttgatacttgatggtatgatcaat |
119 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53811054 |
gtggtttcaactcaatggatta-cagctttgggtattcaaaatattgtctatgaagtagattgtaagcaagtatagttgatacttgatggtatgatcaat |
53810956 |
T |
 |
Q |
120 |
gttaatctaattgaacggactatgtgtccatcatagatcaatgtagagacatattagataactataacaactttcatgtt |
199 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53810955 |
gttaatctaattgaacggactatgtgtccatcatagatcaatgtagagacatattagataactataacaactttcatgtt |
53810876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1942 times since January 2019
Visitors: 2201