View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_321 (Length: 213)
Name: NF0154_2D_low_321
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_321 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 151 - 204
Target Start/End: Original strand, 12355218 - 12355271
Alignment:
Q |
151 |
caataaggtagacgacatagaaccacctattttctaccagattgttgatgtcca |
204 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||||||||| |||| ||||| |
|
|
T |
12355218 |
caataaggtagacggcatagaaccacctattttctaccagattattgaagtcca |
12355271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1526 times since January 2019
Visitors: 2192