View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_322 (Length: 213)
Name: NF0154_2D_low_322
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_low_322 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 14 - 125
Target Start/End: Original strand, 44914074 - 44914185
Alignment:
| Q |
14 |
agtgaaacaataaaaaataacctctnnnnnnnntccacaatctccaaatatttgttgcaaccattgtacatcttatatattgcattgcatatacattctc |
113 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44914074 |
agtgaaacaataaaaaataacccctaaaaaaaatccacaatctccaaatatttgttgcaaccattgtacatcttatatattgcattgcatatacattctc |
44914173 |
T |
 |
| Q |
114 |
aagaattgaaaa |
125 |
Q |
| |
|
|||||||||||| |
|
|
| T |
44914174 |
aagaattgaaaa |
44914185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University