View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_331 (Length: 212)
Name: NF0154_2D_low_331
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_331 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 17 - 149
Target Start/End: Original strand, 25707502 - 25707636
Alignment:
Q |
17 |
catcacagcatagataagaggaggaacaatactcgtatctgtatagaaac--aaccaaacaaacatcaatgtaaaaatcacattcggagacaaaaactag |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||| | ||||||||||||||||||||||||| |
|
|
T |
25707502 |
catcacagcatagataagaggaggaacaatactcgtatctgtatagaaacaaaaccaaacaaacatcgatgtcagaatcacattcggagacaaaaactag |
25707601 |
T |
 |
Q |
115 |
acatcctagttccaaacatgcacatagtgtaatac |
149 |
Q |
|
|
||||| | || |||||||||||||||||| |||| |
|
|
T |
25707602 |
acatcttgatttcaaacatgcacatagtgtgatac |
25707636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1496 times since January 2019
Visitors: 2192