View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_350 (Length: 202)
Name: NF0154_2D_low_350
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0154_2D_low_350 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 42215693 - 42215864
Alignment:
Q |
18 |
ctctcccacaacaagctctcagggaatttagatgctctttctaaccttcataatcttgtttctttaaatgtttccttcaatgaattctctggtgaattgc |
117 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42215693 |
ctctcccacaacaagctctcagggaatttagatgctatttctaaccttcataatcttgtttctttaaatgtttccttcaatgaattctctggtgaattgc |
42215792 |
T |
 |
Q |
118 |
ctaactcaccattctttaggaaactccctttcagtgatctcactggaaataaaggtcttcacattcctgatg |
189 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42215793 |
ctaactcaccattctttaggaaactccctttcagtgatctcactggaaataaaggtcttcacattcctgatg |
42215864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 18 - 182
Target Start/End: Original strand, 24157471 - 24157635
Alignment:
Q |
18 |
ctctcccacaacaagctctcagggaatttagatgctctttctaaccttcataatcttgtttctttaaatgtttccttcaatgaattctctggtgaattgc |
117 |
Q |
|
|
||||| || ||||| |||||||||||||||||| |||| ||| ||||||| ||||||||||| ||||||||||||||||||| ||||||||| | || | |
|
|
T |
24157471 |
ctctcacataacaaactctcagggaatttagatcctctatctgaccttcaaaatcttgtttccttaaatgtttccttcaatgccttctctggtaagttac |
24157570 |
T |
 |
Q |
118 |
ctaactcaccattctttaggaaactccctttcagtgatctcactggaaataaaggtcttcacatt |
182 |
Q |
|
|
||||| |||||||||| || |||||| |||||||||| | | |||| |||||||| ||||| |
|
|
T |
24157571 |
ctaacacaccattcttccataatctccctctcagtgatcttgccgaaaatgaaggtctttacatt |
24157635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1687 times since January 2019
Visitors: 2195