View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_2D_low_88 (Length: 437)
Name: NF0154_2D_low_88
Description: NF0154_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_2D_low_88 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 8e-68; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 257 - 394
Target Start/End: Original strand, 4233988 - 4234126
Alignment:
| Q |
257 |
aagaagatttgttatgcgcaca-atgatgatgaaaagtctctgaagaacgtttctgagcaggtatggtcttgtatttttattatccatatggtgatcaaa |
355 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4233988 |
aagaagatttgttatgcgcacatatgatgatgaaaagtctctgaagaacgtttctgagcaggtatggtcttgtatttttattatccatatggtgatcaaa |
4234087 |
T |
|
| Q |
356 |
atcagttcttatggttctttaatgttcaacctcgggtaa |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4234088 |
atcagttcttatggttctttaatgttcaacctcgggtaa |
4234126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 21 - 84
Target Start/End: Original strand, 4233784 - 4233847
Alignment:
| Q |
21 |
tggaagaatttattcagtcatctgcgtcaaagaagatttgtgttgtaagcaacttgttgataat |
84 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4233784 |
tggaagaatttattcagtcatctgcatcaaagaagatttgtgttgtaagcaacttgttgataat |
4233847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 111 - 182
Target Start/End: Original strand, 4233848 - 4233913
Alignment:
| Q |
111 |
ggcttcaccagttcccttgcaagctccaccacacgataaagtaaagctaaagcataattcttctgtaatgtg |
182 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4233848 |
ggcttcaccagttcccttgcaagctccaccacacgataaag------taaagcataattcttctgtaatgtg |
4233913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 70; Significance: 2e-31; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 302 - 394
Target Start/End: Complemental strand, 36513824 - 36513728
Alignment:
| Q |
302 |
aacgtttctgagcaggtatggtcttgtatttttattatccatatggt-----gatcaaaatcagttcttatggttctttaatgttcaacctcgggtaa |
394 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36513824 |
aacgtttctga-caggtatggtcttgtatttttattatccatatggtacgttgatcaaaatcagttcttatggttctttaatgttcaacctcgggtaa |
36513728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 257 - 303
Target Start/End: Complemental strand, 36513905 - 36513859
Alignment:
| Q |
257 |
aagaagatttgttatgcgcacaatgatgatgaaaagtctctgaagaa |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36513905 |
aagaagatttgttatgcgcacaatgatgatgaaaagtctctgaagaa |
36513859 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 21 - 62
Target Start/End: Complemental strand, 36514128 - 36514087
Alignment:
| Q |
21 |
tggaagaatttattcagtcatctgcgtcaaagaagatttgtg |
62 |
Q |
| |
|
|||||||| ||||||||||| |||| |||||||||||||||| |
|
|
| T |
36514128 |
tggaagaacttattcagtcaactgcatcaaagaagatttgtg |
36514087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1994 times since January 2019
Visitors: 2203