View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_low_1 (Length: 478)
Name: NF0154_low_1
Description: NF0154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 6 - 413
Target Start/End: Complemental strand, 20236764 - 20236357
Alignment:
| Q |
6 |
agcagcacagatggtcgtgtggtcctgctaatctgttccgcaaaatggcgatggagattataaggaacaaggtatgtttgtttgttaagattaagaataa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
20236764 |
agcagcacagatggtcgtgtggtcctgctaatctgttccgcaaaatggcgatggagattataaggaacaaggtatgtttgtttgttaagattaagaatga |
20236665 |
T |
|
| Q |
106 |
agagacaaaaaacttaattctattttcatttatgttccgaattttaatgatgttctgttttggtttttgtgtgcagaaagtgaagttctggaaaaaagtg |
205 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
20236664 |
agagacaaagaacttaattctattttcatttatgttccgaattttaatgatgttctgttttggtttttgtgtgcagaaagtgaagttctggaagaaagtg |
20236565 |
T |
|
| Q |
206 |
tatgttatatacagctttttccttgttcgcaagatcgtagctcacatggtcactttcttcttctactgtcttgtaattcccctcacaattttggttcctg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20236564 |
tatgttatatacagctttttccttgttcgcaagatcgtagctcacatggtcactttcttcttctactgtcttgtaattcccctcacaattttggttcctg |
20236465 |
T |
|
| Q |
306 |
aggtttatgttccaatttggggagctgtttacattccttccatcatcaccattctcaactcagtcggaacaccaaggttcgattaatttcctatcatgtt |
405 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||| |||||||||| |
|
|
| T |
20236464 |
aggttcatgttccaatttggggagctgtttacattccttccatcatcaccattctcaactcagtcggaacaccaaggtccgattacttttctatcatgtt |
20236365 |
T |
|
| Q |
406 |
atcatatc |
413 |
Q |
| |
|
|||||||| |
|
|
| T |
20236364 |
atcatatc |
20236357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6769 times since January 2019
Visitors: 9312