View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_low_10 (Length: 264)
Name: NF0154_low_10
Description: NF0154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 165
Target Start/End: Complemental strand, 52036037 - 52035876
Alignment:
| Q |
1 |
cagactaacaacagtagttgccttgcctaatgttgaggcatcccctgttcccacagaaaacggttaaataatggttaatgtaatctattgagtggtttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
52036037 |
cagactaacaacagtagttgccttgccttatgttgaggcatcccctgttcccacagaaaacggttaaat---ggttaatgtaatctattgagtggtttat |
52035941 |
T |
|
| Q |
101 |
caattccatcctcttacatttttcattcattcttttcatcaattatccaaacaacttgcaagaac |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52035940 |
caattccatcctcttacatttttcattcattcttttcatcaattatccaaacaacttgcaagaac |
52035876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 7013 times since January 2019
Visitors: 9375