View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_low_14 (Length: 232)
Name: NF0154_low_14
Description: NF0154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 42326016 - 42326131
Alignment:
| Q |
1 |
tttaaattttataagcaaaaaatgtatcatatgcatacaaaaatgtcttatgtatcacaaaatttgttttaaatctcacttacttttaaagtatatgatt |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42326016 |
tttaaattttataagcaaaaaatttatcatatgcatacaaaaatgtcttatgtatcacaaaatttgttttaaatctcacttacttttaaagtatatgatt |
42326115 |
T |
 |
| Q |
101 |
taagtattttattgtg |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42326116 |
taagtattttattgtg |
42326131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 91
Target Start/End: Complemental strand, 29791586 - 29791553
Alignment:
| Q |
58 |
caaaatttgttttaaatctcacttacttttaaag |
91 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
29791586 |
caaaacttgttttaaatctcacttacttttaaag |
29791553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University