View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_low_14 (Length: 232)

Name: NF0154_low_14
Description: NF0154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_low_14
NF0154_low_14
[»] chr5 (2 HSPs)
chr5 (1-116)||(42326016-42326131)
chr5 (58-91)||(29791553-29791586)


Alignment Details
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 42326016 - 42326131
Alignment:
1 tttaaattttataagcaaaaaatgtatcatatgcatacaaaaatgtcttatgtatcacaaaatttgttttaaatctcacttacttttaaagtatatgatt 100  Q
    ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42326016 tttaaattttataagcaaaaaatttatcatatgcatacaaaaatgtcttatgtatcacaaaatttgttttaaatctcacttacttttaaagtatatgatt 42326115  T
101 taagtattttattgtg 116  Q
    ||||||||||||||||    
42326116 taagtattttattgtg 42326131  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 58 - 91
Target Start/End: Complemental strand, 29791586 - 29791553
Alignment:
58 caaaatttgttttaaatctcacttacttttaaag 91  Q
    ||||| ||||||||||||||||||||||||||||    
29791586 caaaacttgttttaaatctcacttacttttaaag 29791553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University