View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0154_low_7 (Length: 285)

Name: NF0154_low_7
Description: NF0154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0154_low_7
NF0154_low_7
[»] chr6 (1 HSPs)
chr6 (55-237)||(6883176-6883345)


Alignment Details
Target: chr6 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 55 - 237
Target Start/End: Original strand, 6883176 - 6883345
Alignment:
55 acatcatcaagaagattagaatagaaagagggtatttacataacaggaggttgataaatgctgtttacagagtgaaaatttggtaaagaatatacaatat 154  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
6883176 acataatcaagaagattagaatagaaagagggtatttacataacaggaggttgataaatgctgtttacatagtgaaaatttggtaaagaatatacaatat 6883275  T
155 aatagnnnnnnnngtgcccacaatacgcaacgagtactgggtacggtaccgggtacatgtagcttgagaggttcgaactgtct 237  Q
    |||||        ||||||||||||||||||||            ||||||||||||||||||||||||||||||||||||||    
6883276 aatag-aaaaaaagtgcccacaatacgcaacga------------gtaccgggtacatgtagcttgagaggttcgaactgtct 6883345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University