View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0154_low_7 (Length: 285)
Name: NF0154_low_7
Description: NF0154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0154_low_7 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 2e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 55 - 237
Target Start/End: Original strand, 6883176 - 6883345
Alignment:
| Q |
55 |
acatcatcaagaagattagaatagaaagagggtatttacataacaggaggttgataaatgctgtttacagagtgaaaatttggtaaagaatatacaatat |
154 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6883176 |
acataatcaagaagattagaatagaaagagggtatttacataacaggaggttgataaatgctgtttacatagtgaaaatttggtaaagaatatacaatat |
6883275 |
T |
|
| Q |
155 |
aatagnnnnnnnngtgcccacaatacgcaacgagtactgggtacggtaccgggtacatgtagcttgagaggttcgaactgtct |
237 |
Q |
| |
|
||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6883276 |
aatag-aaaaaaagtgcccacaatacgcaacga------------gtaccgggtacatgtagcttgagaggttcgaactgtct |
6883345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 6706 times since January 2019
Visitors: 9301