View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0155-INSERTION-1 (Length: 501)
Name: NF0155-INSERTION-1
Description: NF0155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0155-INSERTION-1 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 323; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 175 - 501
Target Start/End: Original strand, 17732744 - 17733070
Alignment:
| Q |
175 |
gaatttcaattttaagggttagggttaaagattaagtggagagagaatttcatttattttttctggaattgatgcaaattttgggttttgtgggttattt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
17732744 |
gaatttcaattttaagggttagggttaaagattaagtggagagagaatttcatttattttttctgaaattgatgcaaattttgggttttgtgggttattt |
17732843 |
T |
 |
| Q |
275 |
ataaatcaaatcaaggaaaaagatttgattttttcatctgggtgtgtgagaaatgatgatggatttggatttgggggtttctgatgagatgttagggact |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17732844 |
ataaatcaaatcaaggaaaaagatttgattttttcatctgggtgtgtgagaaatgatgatggatttggatttgggggtttctgatgagatgttagggact |
17732943 |
T |
 |
| Q |
375 |
tttgctccacttttagtttattggatttattctggtttttatgttgttttggggttgtttgctgaagattataggttacatacaaaacaagatgaggatg |
474 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17732944 |
tttgctccacttttagtttattggatttattctggtttttatgttgttttggggttgtttgctgaagattataggttacatacaaaacaagatgaggatg |
17733043 |
T |
 |
| Q |
475 |
ataagaatttggtttctaagtttgatg |
501 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
17733044 |
ataagaatttggtttctaagtttgatg |
17733070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 17733066 - 17733244
Alignment:
| Q |
1 |
tgatgttgttaaaggtgttcttcttcaacaagctgttcaagctgtggttgcaacccttttgtttgcagtaagttttttgagatgcaaagtttttacagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17733066 |
tgatgttgttaaaggtgttcttcttcaacaagctgttcaagctgtggttgcaacccttttgtttgcagtaagttttttgagatgcaaagtttttacagct |
17733165 |
T |
 |
| Q |
101 |
ttcctttattcggtcggtagacggtgcgacaaatatcacatgaaactcacacacaaatgagaggtcccaggttcgaatt |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
17733166 |
ttcctttattcggtcggtagacggtgcgacaaatatcacatgaaactcacacacaaatgagagttcccaggtttgaatt |
17733244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 342 - 445
Target Start/End: Complemental strand, 365375 - 365272
Alignment:
| Q |
342 |
gatttgggggtttctgatgagatgttagggacttttgctccacttttagtttattggatttattctggtttttatgttgttttggggttgtttgctgaag |
441 |
Q |
| |
|
||||||||| |||| |||||||| | | |||||||| || ||| |||||||||| || |||| ||| |||||||||| |||||| ||||||||||||| |
|
|
| T |
365375 |
gatttggggatttcagatgagatttgaaagacttttggtcagcttctagtttattgtatctattttggcttttatgttgatttgggattgtttgctgaag |
365276 |
T |
 |
| Q |
442 |
atta |
445 |
Q |
| |
|
|||| |
|
|
| T |
365275 |
atta |
365272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 143 - 179
Target Start/End: Original strand, 29009681 - 29009717
Alignment:
| Q |
143 |
aaactcacacacaaatgagaggtcccaggttcgaatt |
179 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||| |
|
|
| T |
29009681 |
aaactcacacacaactgtgaggtcccaggttcgaatt |
29009717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University