View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0155-INSERTION-5 (Length: 209)
Name: NF0155-INSERTION-5
Description: NF0155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0155-INSERTION-5 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 853681 - 853475
Alignment:
Q |
1 |
taaaattgcataggtgttgatgacaagtgatacagcaactttggagatggatgatgagggtaagctaggaacaattctgataacaaacgatgatggtatt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
853681 |
taaaattgcataggtgttgatgacaagtgatacagcaactttggagatggatgatgagggtaagctaggaacaattctgataacaaacgatgatggtatt |
853582 |
T |
 |
Q |
101 |
gatgctcctggtttgagagctttggttgaatccctggttaacaccaatctttttaatgtcttggtctgtgtgctcctgataggtaagtaaatcaggttcc |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
853581 |
gatgctcctggtttgagagctttggttgaatccctcgttaacaccaatctttttaatgtcttggtc--tgtgctcctgataggtaagtaaatcaggttcc |
853484 |
T |
 |
Q |
201 |
gtcatgatc |
209 |
Q |
|
|
||||||||| |
|
|
T |
853483 |
gtcatgatc |
853475 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University