View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0155-INSERTION-7 (Length: 302)
Name: NF0155-INSERTION-7
Description: NF0155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0155-INSERTION-7 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 7e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 114 - 302
Target Start/End: Original strand, 20217409 - 20217596
Alignment:
| Q |
114 |
actagtttccagagtttattttgttgaatgagtttcctttttatctatgattaatttgattgattattgtatcttgtaaggttggcttacttgcacgagg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
20217409 |
actagtttccagagtttattttgttgaatgagtttcctttttatctatgattaatttgattgattattgtatcttgta-ggctggcttacttgcacgagg |
20217507 |
T |
|
| Q |
214 |
cgattgagccaaaagttgtacatcgagatattaattcgagcaatattctaattgatgatagctttaatgctaaaatttctgactttggg |
302 |
Q |
| |
|
| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
20217508 |
caattgagccaaaagttgtacatcgagatattaagtcgagcaatattctaattgacgatagctttaatgctaaaatatctgactttggg |
20217596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 196 - 301
Target Start/End: Complemental strand, 51063571 - 51063466
Alignment:
| Q |
196 |
tggcttacttgcacgaggcgattgagccaaaagttgtacatcgagatattaattcgagcaatattctaattgatgatagctttaatgctaaaatttctga |
295 |
Q |
| |
|
||||||||||||||||||| |||||||| |||||||| ||||||||||| || || || |||||||| ||||||||| ||| ||||| ||||| ||||| |
|
|
| T |
51063571 |
tggcttacttgcacgaggcaattgagccgaaagttgtccatcgagatatcaagtcaagtaatattcttattgatgatgacttcaatgccaaaatatctga |
51063472 |
T |
|
| Q |
296 |
ctttgg |
301 |
Q |
| |
|
|||||| |
|
|
| T |
51063471 |
ctttgg |
51063466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1456 times since January 2019
Visitors: 2192