View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0156-INSERTION12 (Length: 178)
Name: NF0156-INSERTION12
Description: NF0156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0156-INSERTION12 |
 |  |
|
[»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 1e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 13 - 178
Target Start/End: Original strand, 32085965 - 32086130
Alignment:
Q |
13 |
acccactcaattcaaccatttgtcaaactttttcaaatttcatggtgatgtcattgcaatctgttaaaatttcatggtacatcgagcttcgtgcggtgtg |
112 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
32085965 |
acccactcaattcaactatttgtcaaactttttcaaatttcatggtgatgtcattgcaatatgttaaaatttcatggtacatcgagcttcatgcggtgtg |
32086064 |
T |
 |
Q |
113 |
gtttggtaggaggaggggatggttgatggtggaaggagaagcataacagagagaatgggtatgtca |
178 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
32086065 |
gtttggtaggaggaggggatggttgatggtggaaggagaagcataacagagagagtgggtatgtca |
32086130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 77 - 148
Target Start/End: Original strand, 32084564 - 32084635
Alignment:
Q |
77 |
taaaatttcatggtacatcgagcttcgtgcggtgtggtttggtaggaggaggggatggttgatggtggaagg |
148 |
Q |
|
|
|||||||||||||||||||||||||| | | ||| |||||| ||||||| ||||||| || |||||||||| |
|
|
T |
32084564 |
taaaatttcatggtacatcgagcttcatacattgtagtttggcaggaggaagggatggatggtggtggaagg |
32084635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University