View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0156-INSERTION12 (Length: 178)

Name: NF0156-INSERTION12
Description: NF0156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0156-INSERTION12
NF0156-INSERTION12
[»] chr3 (2 HSPs)
chr3 (13-178)||(32085965-32086130)
chr3 (77-148)||(32084564-32084635)


Alignment Details
Target: chr3 (Bit Score: 150; Significance: 1e-79; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 13 - 178
Target Start/End: Original strand, 32085965 - 32086130
Alignment:
13 acccactcaattcaaccatttgtcaaactttttcaaatttcatggtgatgtcattgcaatctgttaaaatttcatggtacatcgagcttcgtgcggtgtg 112  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||    
32085965 acccactcaattcaactatttgtcaaactttttcaaatttcatggtgatgtcattgcaatatgttaaaatttcatggtacatcgagcttcatgcggtgtg 32086064  T
113 gtttggtaggaggaggggatggttgatggtggaaggagaagcataacagagagaatgggtatgtca 178  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
32086065 gtttggtaggaggaggggatggttgatggtggaaggagaagcataacagagagagtgggtatgtca 32086130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 77 - 148
Target Start/End: Original strand, 32084564 - 32084635
Alignment:
77 taaaatttcatggtacatcgagcttcgtgcggtgtggtttggtaggaggaggggatggttgatggtggaagg 148  Q
    |||||||||||||||||||||||||| | |  ||| |||||| ||||||| ||||||| || ||||||||||    
32084564 taaaatttcatggtacatcgagcttcatacattgtagtttggcaggaggaagggatggatggtggtggaagg 32084635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University