View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0156-INSERTION7 (Length: 215)
Name: NF0156-INSERTION7
Description: NF0156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0156-INSERTION7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 134; Significance: 6e-70; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 134; E-Value: 6e-70
Query Start/End: Original strand, 8 - 211
Target Start/End: Complemental strand, 26328145 - 26327934
Alignment:
Q |
8 |
atttgtactaagatcatctatatacgaagagaatttgacaccacattttataacaaaccttaagacatttgataaataggtcttctcacnnnnnnnn--- |
104 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
26328145 |
atttgtactaagatcatctatatacgaagagaatttgacatcacattttataacaaactttaagacatttgataaataggtcttctcacttttttttttt |
26328046 |
T |
 |
Q |
105 |
----gaaagaacgaatcttctcattaagttattaacattcactttttca-ttcaacgtaagtcttatgtcacacatttgcgtaccaagtccataagatgt |
199 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||| | |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26328045 |
ttttgaaagaatgaatcttctcattaagttattaacattcacttttttaattcaacctaagtcttatgtcacacatttgcgtaccaagtccataagatgt |
26327946 |
T |
 |
Q |
200 |
atgattgtattt |
211 |
Q |
|
|
|||||||||||| |
|
|
T |
26327945 |
atgattgtattt |
26327934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University