View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0156-INSERTION9 (Length: 199)
Name: NF0156-INSERTION9
Description: NF0156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0156-INSERTION9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 63; Significance: 1e-27; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 7 - 69
Target Start/End: Complemental strand, 8971941 - 8971879
Alignment:
| Q |
7 |
aacatcatttatcttcaattgatctcactttcgatcacatcaaggctgtccttgcggtatgtt |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8971941 |
aacatcatttatcttcaattgatctcactttcgatcacatcaaggctgtccttgcggtatgtt |
8971879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 8e-26
Query Start/End: Original strand, 123 - 190
Target Start/End: Complemental strand, 8971826 - 8971759
Alignment:
| Q |
123 |
atatacatattctaccaattaattatgtttttgtcctttacctacacatgttttctgtcgctatagga |
190 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8971826 |
atatacatattctaccaaataattatgtttttgtcctttgcctacacatgttttctgtcgctatagga |
8971759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 7 - 69
Target Start/End: Original strand, 9027860 - 9027922
Alignment:
| Q |
7 |
aacatcatttatcttcaattgatctcactttcgatcacatcaaggctgtccttgcggtatgtt |
69 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||| ||||| || | |||||||| |
|
|
| T |
9027860 |
aacatcatttgtcttcaattgatctcactttcaatcacatcaaagctgttctcgtggtatgtt |
9027922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 832 times since January 2019
Visitors: 1512