View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0156_low_10 (Length: 295)
Name: NF0156_low_10
Description: NF0156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0156_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 47 - 285
Target Start/End: Original strand, 38359987 - 38360225
Alignment:
| Q |
47 |
aaaatcacctgaaacttttcatgttttttggacatcataaggatagctgaaagaaattggtccccgcattgtagattggttgctctatctgccataattc |
146 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
38359987 |
aaaatcacctgaaacttttcaagttttttggacatcataaggatagctaaaagaaattggtccccacaatgtagactggttgctctatctgccataattc |
38360086 |
T |
 |
| Q |
147 |
acttcttcaacaccaactggttttgcataaaccaaagaagatttaatgctaagataatcaatgtcagatatgttgtcaacatggttatctcaggtgcttc |
246 |
Q |
| |
|
||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38360087 |
actgcttcaacaccatctggttttgcataaaccaaagaagatttaatgctaagataatcaatgtcagatatgttgtcaacatggttatctcaggtgcttc |
38360186 |
T |
 |
| Q |
247 |
tcgttctggcaacaactcacttatatctgctaattcatc |
285 |
Q |
| |
|
| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38360187 |
ttgttctggcaacaactcacttctatctgctaattcatc |
38360225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University