View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0156_low_11 (Length: 292)
Name: NF0156_low_11
Description: NF0156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0156_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 8437922 - 8438205
Alignment:
| Q |
1 |
ataaaccttaacacatggcccacaatgtttaagaccaacatcaagaacaataagcttatgatcaatcttatgatcctcaataagtttctcaacatcttct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8437922 |
ataaaccttaacacatggcccacaatgtttaagaccaacatcaagaacaataagcttatgatcaatcttatgatcctcaataagtttctcaacatcttct |
8438021 |
T |
 |
| Q |
101 |
ctgttgtgaagttgcactacacctgaatggttatcaccgtagtataacacatcaccaacaagcatatctggaccaatagcttcttcttcatgaatttttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438022 |
ctgttgtgaagttgcactacacctgaatggttatcaccgtagtataaaacatcaccaacaagcatatctggaccaatagcttcttcttcatgaatttttt |
8438121 |
T |
 |
| Q |
201 |
ctttgctcttgtagaaagtgaagtgtggtactttatcaaccttttctcttttacagagttcttttgttttctctgattcatctc |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438122 |
ctttgctcttgtagaaagtgaagtgtggtactttatcaaccttttctcttttacagagttcttttgttttctctgattcatctc |
8438205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University