View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0156_low_9 (Length: 310)
Name: NF0156_low_9
Description: NF0156
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0156_low_9 |
 |  |
|
[»] scaffold0085 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0085 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: scaffold0085
Description:
Target: scaffold0085; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 71 - 222
Target Start/End: Complemental strand, 42684 - 42533
Alignment:
Q |
71 |
cagagagctagtccttttggttgataaataattagcatagctatagcatcatctgtcatattcatccctgtgaagttaaatttgaccagttatgtagtac |
170 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
T |
42684 |
cagagagctagtccttttggttgataaataattagcatagctatagtatcatctgtcatattcatccctgtgaagttaaatttgaccagctatgtagtac |
42585 |
T |
 |
Q |
171 |
atgaagaatcgtgactagcaagtaaatgttaacttcacataatcccaggcgc |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42584 |
atgaagaatcgtgactagcaagtaaatgttaacttcacataatcccaggcgc |
42533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University