View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0157-INSERTION-3 (Length: 151)
Name: NF0157-INSERTION-3
Description: NF0157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0157-INSERTION-3 |
 |  |
|
[»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 1e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 1e-76
Query Start/End: Original strand, 7 - 151
Target Start/End: Complemental strand, 53553260 - 53553116
Alignment:
Q |
7 |
atatatgtatataataaagtcagctgaattagtttgactttaagacaaaggtccactgcgtgtgttaggtatgaagtaagcagtactaatagaggggcag |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53553260 |
atatatgtatataataaagtcagctgaattagtttgactttaagacaaaggtccactgcgtgtgttaggtatgaagtaagcagtactaatagaggggcag |
53553161 |
T |
 |
Q |
107 |
aggagtagatattgatgattgtgtcacgcaaattgaccttgtgga |
151 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53553160 |
aggagtagatattgatgattgtgtcacgcaaattgaccttgtgga |
53553116 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University