View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0157_high_12 (Length: 278)

Name: NF0157_high_12
Description: NF0157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0157_high_12
NF0157_high_12
[»] chr4 (1 HSPs)
chr4 (122-229)||(9471600-9471706)


Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 122 - 229
Target Start/End: Original strand, 9471600 - 9471706
Alignment:
122 gagatcgatgtcgtgattaataagagatcgtcttgtctcttgtcaagaatgaaaatgttaaaagttggggaaaaggtgtcatgtgggatgtggggggaat 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
9471600 gagatcgatgtcgtgattaataagagatcgtcttgtctcttgtcaagaatgaaaatgtt-aaagttggggaaaaggtgtcatgtgggatgtggggggaat 9471698  T
222 aggatgat 229  Q
    ||||||||    
9471699 aggatgat 9471706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University