View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0157_low_23 (Length: 316)
Name: NF0157_low_23
Description: NF0157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0157_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 91 - 315
Target Start/End: Complemental strand, 13886597 - 13886373
Alignment:
Q |
91 |
atcatagggaatgctgaaatgcatgaattgaatatgttgtgttatattgaagtgttttttgcgtctaccttttggtttgatttgatgagctgaaaaattt |
190 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13886597 |
atcatagggaatgctgaaatgcatgaattgaatatgttgtgttatattgaagtgttttttgcgtctaccttttggtttgatttgatgagctgaaaaattt |
13886498 |
T |
 |
Q |
191 |
atgtttgtgaaaaattggttaacttttgaaatgactaagtgattgtaatttctttcccttgaattatggtttttggggactttgagaatgtttggtttgt |
290 |
Q |
|
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
13886497 |
atgtttgtggaaaattggttaacttttgaaatgactaagtgattgtaatttctttcccttgaattatggtttttggggactttgagaatgtttggtttgt |
13886398 |
T |
 |
Q |
291 |
tgtgatttaagaatagagttgttgg |
315 |
Q |
|
|
|| |||||||||||||||||||||| |
|
|
T |
13886397 |
tgagatttaagaatagagttgttgg |
13886373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 260 - 316
Target Start/End: Original strand, 13898628 - 13898684
Alignment:
Q |
260 |
tttttggggactttgagaatgtttggtttgttgtgatttaagaatagagttgttggt |
316 |
Q |
|
|
|||||||||||||||||||||||| | |||||| ||||| |||||||| || ||||| |
|
|
T |
13898628 |
tttttggggactttgagaatgttttgattgttgggatttgagaatagaattcttggt |
13898684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University