View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0157_low_25 (Length: 293)
Name: NF0157_low_25
Description: NF0157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0157_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 64 - 193
Target Start/End: Original strand, 22016230 - 22016363
Alignment:
Q |
64 |
tttatgacaggttttgat---tgtagttaagcccactagtaagaaaaggttttgttgttgttcagttgttttccctcctagcatatacataccgtgttgg |
160 |
Q |
|
|
|||| ||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| ||| ||| ||||||| |
|
|
T |
22016230 |
tttaagacaggttttgatggctgtagttaagccgactagtgagaaaaggttttgttgttgttcagttgttttccctcctagcatgtacgtactgtgttgg |
22016329 |
T |
 |
Q |
161 |
-aaaagctgcctgagtttcaatccacctctagct |
193 |
Q |
|
|
||||||||||||||||||||||||||||||||| |
|
|
T |
22016330 |
aaaaagctgcctgagtttcaatccacctctagct |
22016363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 191 - 276
Target Start/End: Original strand, 22016398 - 22016483
Alignment:
Q |
191 |
gcttcctctagtatctttgttgtgctggtgtgaagagtgtgttttgactttagtttcacatcctctagaaatatggctttaatagt |
276 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
22016398 |
gcttcctctagtatctttgttgtgctggtgtgaagagtgtgttttgactttagtttcacatcatctagaaatatggctttaatagt |
22016483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University