View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0157_low_27 (Length: 286)
Name: NF0157_low_27
Description: NF0157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0157_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 16 - 264
Target Start/End: Original strand, 32313618 - 32313866
Alignment:
| Q |
16 |
atggacatcatcaaacactagtacatttgattttagttttactacaagatagactcactttcctgccaggacttgctttcagaaaacttagtgtgccatc |
115 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32313618 |
atggacatcaccaaacactagtacatttgattttagttttactacaagattgactcactttcctgccaggacttgctttcagaaaacttagtgtgccatc |
32313717 |
T |
|
| Q |
116 |
attttcaatttcaaaatttcaccatattgtaaaaattgaataaaaaacgatcagaactatcgttttcagttattaggtactatgatttccatgcattact |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32313718 |
attttcaatttcaaaatttcaccatattgtaaaaattgaataaaaaacgatcagaactatcgttttcagttattaagtactatgatttccatgcattact |
32313817 |
T |
|
| Q |
216 |
ttaattttttaaattttctattgaaccattcacaagtcttaatgatgat |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32313818 |
ttaattttttaaattttctattgaaccattcataagtcttaatgatgat |
32313866 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1040 times since January 2019
Visitors: 2243