View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0157_low_30 (Length: 280)
Name: NF0157_low_30
Description: NF0157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0157_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 3e-54; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 55 - 240
Target Start/End: Original strand, 6883176 - 6883348
Alignment:
Q |
55 |
acatcatcaagaagattagaatagaaagagggtatttacataacaggaggttgataaatgctgtttacagagtgaaaatttggtaaagaatatacaatat |
154 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
6883176 |
acataatcaagaagattagaatagaaagagggtatttacataacaggaggttgataaatgctgtttacatagtgaaaatttggtaaagaatatacaatat |
6883275 |
T |
 |
Q |
155 |
aatagnnnnnnnngtgcccacaatacgcaacgagtactgggtacggtaccgggtacatgtagcttgagaggttcgaactgtctgtg |
240 |
Q |
|
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6883276 |
aatag-aaaaaaagtgcccacaatacgcaacga------------gtaccgggtacatgtagcttgagaggttcgaactgtctgtg |
6883348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University