View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0157_low_32 (Length: 278)
Name: NF0157_low_32
Description: NF0157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0157_low_32 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 122 - 229
Target Start/End: Original strand, 9471600 - 9471706
Alignment:
Q |
122 |
gagatcgatgtcgtgattaataagagatcgtcttgtctcttgtcaagaatgaaaatgttaaaagttggggaaaaggtgtcatgtgggatgtggggggaat |
221 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9471600 |
gagatcgatgtcgtgattaataagagatcgtcttgtctcttgtcaagaatgaaaatgtt-aaagttggggaaaaggtgtcatgtgggatgtggggggaat |
9471698 |
T |
 |
Q |
222 |
aggatgat |
229 |
Q |
|
|
|||||||| |
|
|
T |
9471699 |
aggatgat |
9471706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University