View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0157_low_35 (Length: 260)
Name: NF0157_low_35
Description: NF0157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0157_low_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 22016577 - 22016815
Alignment:
| Q |
1 |
taaggttacttttgtaagtgctgctttgtgatgacttagcatagtgaatttgaaattatctcttactatgcaattcctgatcgatttttgtgttctacgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016577 |
taaggttacttttgtaagtgctgctttgtgatgacttagcatagtgaatttgaaattatctcttactatgcaattcctgatcgatttttgtgttctacgc |
22016676 |
T |
|
| Q |
101 |
tatttaccgaagcctcctcagatgaattgtctggatgaaattcaaccttattgtgaagagcaagcaaaagatgatctatccatggtagaaactgaacgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016677 |
tatttaccgaagcctcctcagatgaattgtctggatgaaattcaaccttattgtgaagagcaagcaaaagatgatctatccatggtagaaactgaacgta |
22016776 |
T |
|
| Q |
201 |
atgaagggacagataataatgaaaataatgctgatgatg |
239 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
22016777 |
atgaagggaaagataataatgaaaataatgctgatgatg |
22016815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 203 - 237
Target Start/End: Original strand, 22016830 - 22016864
Alignment:
| Q |
203 |
gaagggacagataataatgaaaataatgctgatga |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
22016830 |
gaagggacagataataatgaaaataatgctgatga |
22016864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University