View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0158_high_10 (Length: 205)
Name: NF0158_high_10
Description: NF0158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0158_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 6e-39; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 6e-39
Query Start/End: Original strand, 15 - 100
Target Start/End: Original strand, 39669959 - 39670044
Alignment:
Q |
15 |
gacatgtcggagtcagcgggagcgtaggatgaggaacagcccgagtaacgaggaacacaacaaagaccaaaaccaagtagtggtag |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
39669959 |
gacatgtcggagtcagcgggagcgtaggatgaggaacagcccgagtaacgaggaacacaacaaagaccaaaaccaagtagtagtag |
39670044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1098 times since January 2019
Visitors: 2243