View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0158_high_2 (Length: 450)
Name: NF0158_high_2
Description: NF0158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0158_high_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 9e-77; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 52 - 233
Target Start/End: Original strand, 39499041 - 39499221
Alignment:
Q |
52 |
catccctaaactaacactctctcgcaaatttagtcactaaattattaatatcaagacttaattgcatttataaccctctaaatttttcaattgtgtaatt |
151 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |||||||||||| |||||||||||||| ||| |
|
|
T |
39499041 |
catccctaaactaacactctctcgcaaatttagtcactaaattatcaaaatcaagacttaattgcattaataaccctctaagtttttcaattgtgtgatt |
39499140 |
T |
 |
Q |
152 |
ttgaacttgtagtttgttatgtgcggttttaacctcctaaatttaccctgtttctgatttgatagcccctcacttaatcttg |
233 |
Q |
|
|
||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
39499141 |
ttgaacttgta-tttgttttgtgcggttttaacctcctaaatttacccagtttctgatttgatagcccctcacttaatcttg |
39499221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 146; E-Value: 9e-77
Query Start/End: Original strand, 52 - 233
Target Start/End: Original strand, 39502380 - 39502560
Alignment:
Q |
52 |
catccctaaactaacactctctcgcaaatttagtcactaaattattaatatcaagacttaattgcatttataaccctctaaatttttcaattgtgtaatt |
151 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |||||||||||| |||||||||||||| ||| |
|
|
T |
39502380 |
catccctaaactaacactctctcgcaaatttagtcactaaattatcaaaatcaagacttaattgcattaataaccctctaagtttttcaattgtgtgatt |
39502479 |
T |
 |
Q |
152 |
ttgaacttgtagtttgttatgtgcggttttaacctcctaaatttaccctgtttctgatttgatagcccctcacttaatcttg |
233 |
Q |
|
|
||||||||||| |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
39502480 |
ttgaacttgta-tttgttttgtgcggttttaacctcctaaatttacccagtttctgatttgatagcccctcacttaatcttg |
39502560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 376 - 441
Target Start/End: Original strand, 39503113 - 39503178
Alignment:
Q |
376 |
ggtttcaaaacgcttttgtccgtgcactgaatcccttctcgcaatcctccaatgcctcgttcatct |
441 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
39503113 |
ggtttcaaaacgcttttgtccgtgcactgaatcccttctcgcaatcctccaatgcctcattcatct |
39503178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 224 - 288
Target Start/End: Original strand, 39502961 - 39503025
Alignment:
Q |
224 |
cttaatcttgcactaagttggcattttgtatgatatgcctcccttgtctctatgccacgtggatt |
288 |
Q |
|
|
|||||| ||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39502961 |
cttaattttgcactgagttggcattatgtatgatatgcctcccttgtctctatgccacgtggatt |
39503025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 53 - 105
Target Start/End: Complemental strand, 421843 - 421791
Alignment:
Q |
53 |
atccctaaactaacactctctcgcaaatttagtcactaaattattaatatcaa |
105 |
Q |
|
|
|||||||||||| ||||||||| | ||||||||| ||||| |||||| ||||| |
|
|
T |
421843 |
atccctaaactatcactctctcaccaatttagtccctaaactattaaaatcaa |
421791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1029 times since January 2019
Visitors: 2243