View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0158_high_8 (Length: 239)
Name: NF0158_high_8
Description: NF0158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0158_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 4 - 170
Target Start/End: Complemental strand, 3283154 - 3282988
Alignment:
| Q |
4 |
ctaaatccatacctttcaggtgctctgttttgtctcatgctttccacttttgttccatatcaaaacaagaccaaatcccatcaaagacataattgcagtc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3283154 |
ctaaatccatacctttcaggtgctctgttttgtctcatgctttccacttttgttccatatcaaaacaagaccaaatcccatcaaagacataattgcagtc |
3283055 |
T |
 |
| Q |
104 |
tgcaaaagaaattagccacttatatttcaatatatcattattttgattcagtgctatacttcatctc |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3283054 |
tgcaaaagaaattagccacttatatttcaatatatcattattttgattcagtgctatacttcgtctc |
3282988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University