View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0158_high_8 (Length: 239)

Name: NF0158_high_8
Description: NF0158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0158_high_8
NF0158_high_8
[»] chr5 (1 HSPs)
chr5 (4-170)||(3282988-3283154)


Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 4 - 170
Target Start/End: Complemental strand, 3283154 - 3282988
Alignment:
4 ctaaatccatacctttcaggtgctctgttttgtctcatgctttccacttttgttccatatcaaaacaagaccaaatcccatcaaagacataattgcagtc 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3283154 ctaaatccatacctttcaggtgctctgttttgtctcatgctttccacttttgttccatatcaaaacaagaccaaatcccatcaaagacataattgcagtc 3283055  T
104 tgcaaaagaaattagccacttatatttcaatatatcattattttgattcagtgctatacttcatctc 170  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
3283054 tgcaaaagaaattagccacttatatttcaatatatcattattttgattcagtgctatacttcgtctc 3282988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 594 times since January 2019
Visitors: 2233