View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0158_high_9 (Length: 216)

Name: NF0158_high_9
Description: NF0158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0158_high_9
NF0158_high_9
[»] chr4 (1 HSPs)
chr4 (1-123)||(39782889-39783011)


Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 1 - 123
Target Start/End: Complemental strand, 39783011 - 39782889
Alignment:
1 gacgagactgaaattgagctgacattaggcccgtcgagttataaccgtagcaagaaaattgaaacaccactaacttcagaatcaggacatagtttgtctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39783011 gacgagactgaaattgagctgacattaggcccgtcgagttataaccgtagcaagaaaattgaaacaccactaacttcagaatcaggacatagtttgtctt 39782912  T
101 catcttcaactggatcaagtgat 123  Q
    |||||||||||||||||||||||    
39782911 catcttcaactggatcaagtgat 39782889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University