View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0158_low_12 (Length: 291)
Name: NF0158_low_12
Description: NF0158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0158_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 134 - 244
Target Start/End: Original strand, 42874900 - 42875010
Alignment:
| Q |
134 |
caaactaataaactatgaaattaagaaacagatgtagaattcatccaataacaatcctattcagttgattgtgatggctctggactcttgaggcagcaat |
233 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42874900 |
caaactaataaactatgaaattaaaaaacagatgtagaattcatccaataataatcctattcagttgattgtgatggctctggactcttgaggcagcaat |
42874999 |
T |
|
| Q |
234 |
aaatctgatat |
244 |
Q |
| |
|
||||||||||| |
|
|
| T |
42875000 |
aaatctgatat |
42875010 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 62 - 135
Target Start/End: Original strand, 42874799 - 42874872
Alignment:
| Q |
62 |
acatcatcatatatcatttttaataaataaaactcaacaataaagaacaattgtattattcaaaacttgaaaca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42874799 |
acatcatcatatatcatttttaataaataaaactcaacaataaagaacaattgtattattcaaaacttgaaaca |
42874872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 983 times since January 2019
Visitors: 2242